primeiro e sétimo lugares medicina ufmg

terça-feira, 22 de abril de 2014

Próximas aulas do curso Por Dentro e listas de questões

Curtir
Patricia FibonacciDarlene Carvalho e outras 51 pessoas curtiram isso.


Hoje (segunda) iniciamos na sala o estudo dos ciclos reprodutivos animal  e vegetal, a gametogênese e  fecundação, as aneuploidias (trissomias e monossomias), as fases da embriogênese e  um pouco da embriogênese dos mamíferos  ( com o estudo do blastocisto).

Essa aula ainda será repetida no sábado, as 13h. Ou seja, aqueles que vão assistir a aula de sábado, façam a lista de fecundação e embriologia,postadas aqui no blog!

Na próxima semana continuaremos a embriogênese com os temas: embriogênese nos mamíferos, anexos embrionários, comparação de protostômios e deuterostômios, doença hemolítica do recém-nascido e células tronco.   Ainda falaremos de tecidos animais e inciaremos o estudo da pele.

Listas para a repetição da primeira aula (no sábado 26) e segunda aula na segunda 29 a seguir, qualquer problema no download me procure pelo facebook ou salabioquimica@gmail.com.


Fecundação (para a repetição da primeira aula, sábado, 26/4)


Embriologia(para a repetição da primeira aula, sábado, 26/4)



TECIDOS (para a segunda aula, dias 29/4 e 3/5)


PELE (para a segunda aula, dias 29/4 e 3/5)

  Pele



SAIBA MAIS



Curtir
Patricia FibonacciDarlene Carvalho e outras 51 pessoas curtiram isso.

sábado, 19 de abril de 2014

Criacionismo, Evolucionismo e bananas

Por Fabio Dias Magalhães


Uma das grandes diferenças do pensamento criacionista para o evolucionista é a crença de que as coisas vivas foram criadas com certa finalidade, o que é a base do design inteligente. Já para evolução a variedade é produzida por eventos ao acaso e aquelas variedades  que permitem maior sucesso sobrevivem.
O video a seguir ilustra um pouco essa visão criacionista:

A banana, "o pesadelo dos ateus"


No vídeo, um senhor defende que a banana foi criada por Deus, e cada parte do fruto foi pensada para melhor servir o homem. É como se a banana sempre tivesse existido,e sempre do mesmo jeito. Essa idéia fixista da diversidade ignora a variedade de bananas que existiram ao longo da história e a intervenção da agricultura que a modificou. Ignora a existência desse fruto com semente, não tão agradável assim e, por isso, não tão proliferado.
Banana selvagem: pouca polpa e sementes duras. Motivos para sua não proliferação pela agricultura.

Esse é  o erro criacionista: acreditar que todas as coisas surgiram do nada, pela intervenção de um Designer Celestial, que projetou e criou a natureza perfeita. E para o homem. Não considera, assim, que a vida se modifica e que existem processos que levaram à diversidade atual.

Esse mesmo pensamento criacionista é aplicado ao corpo.

 O corpo teria uma suposta perfeição, e ele seria  um dos argumentos do design inteligente, ou seja, que o corpo é produto perfeito do projeto de um criador.  E nós professores de biologia temos um pouco de culpa nisso, já que muitas vezes mostramos o corpo como uma máquina de funcionamento perfeito.  Nada mais distante disso. O corpo  tem várias falhas, as quais chamamos de doenças. Obviamente os corpos que conseguem sobreviver e reproduzir apesar de suas falhas são aqueles mais frequentes. A isso chamamos de sobrevivência do mais apto ou seleção natural. Então o termo "normal"  usado para certo corpo é meramente um conceito estatístico, ou seja, é o corpo "mais comum". E é o mais frequente justamente por uma questão de seleção natural: é  o corpo que funciona melhor para certo ambiente.

O conceito de seleção natural foi inspirado em outro conceito, o de seleção artificial.  Essa envolve cruzamentos controlados  e seleção de variedades de interesse humano.  Ela é a base da agricultura e explica porque hoje temos variedades  tão economicamente interessantes apesar de tão pouco aptas a sobreviver sem a intervenção humana. Exemplo disso é a banana, fruto partenocárpico resultado de várias gerações de seleção artificial.  Charles Darwin escreveu sobre os efeitos da seleção artificial em pombos, dentre outros animais. A partir da variedade  encontrada na natureza, o homem replicou aquelas de seu interesse, modificando, assim , as espécies. A partir disso temos as variedades da agricultura, da pecuária, a raciação canina e as praticas de cruzamentos controlados até hoje feitas.

Ora, se o homem pode produzir variedades através de cruzamentos controlados ,  na natureza deve haver algum processo semelhante, em que as espécies se modificam. A partir daí pensou-se em um conceito de seleção natural ou sobrevivência do mais apto.

Não, o corpo não é perfeito e harmônico. Ele é falho. Se as falhas levam a esterilidade, esse corpo não prolifera. Se falhas ocorrem ja na criança, levando a morte, idem. Mas, se essas ocorrem depois da idade reprodutiva, esses corpos conseguem se proliferar. O que vemos hoje não são organismos perfeitos, mas organismos em que seus ancestrais conseguiram sobreviver porque suas características  permitiram sua adaptação ao ambiente.

E não, a natureza não é perfeita e harmônica. Ela é em grande parte desarmônica. E são nessas relações desarmônicas, nessa luta pela sobrevivência, é que o mais apto garante sua reprodução. Sem duvida essa diversidade nos impressiona.  Animais, plantas, os microorganismos, tudo é impressionante.  E assim como as crianças desenham um sol com rosto, personificando a natureza, nós, Homo sapiens, tão novos por aqui, personificamos processos, e pensamos que haja um criador.
video
Alice explicando a chuva. "Quem colocou a água no céu?" Ela responde "Papai do céu, para chover todo dia". 


E só mesmo primatas para ver uma banana e pensar que ela é uma evidência da existência de Deus...




SAIBA MAIS
Curso Genética e Evolução
Curso Por Dentro
Evolução: a resposta biológica para a pergunta da diversidade

sexta-feira, 18 de abril de 2014

Organelas citoplasmáticas

por Fabio Dias Magalhães

Nosso objetivo aqui é diferenciar a célula eucariota da procariota,  comentando as funções de suas organelas citoplasmáticas.

A célula eucariota é compartimentada

As células apresentam, todas elas, membrana plasmática, limitando o meio interno celular.  A diferença das células eucariotas das procariotas é que as primeiras apresentam, além da membrana plasmática, outras estruturas membranosas, que levam à separação das células eucariotas em compartimentos, as organelas.

FIGURA 1 Célula eucariota animal (A) é compartimentada por organelas, o que não ocorre na célula procariota (B). O que  isso interfere nos fenômenos de transcrição e tradução? Quais são as funções das organelas mostradas na figura?

FIGURA 2 :A célula vegetal apresenta cloroplastos e parede celular. Os plasmodesmos permitem  a comunicação entre as células.


 Toda (ou quase toda) célula apresenta DNA como material genético. E esse ácido tem duas propriedades: a duplicação e a transcrição. A duplicação é um pre-requisito para a divisão celular. Já a transcrição é uma etapa fundamental a tradução, quando aminoácidos se ligam formando proteínas, no ribossomo.

Enquanto o DNA é disperso pelo citoplasma bacteriano, nas células eucariotas ele se encontra em compartimentos: núcleo, mitocôndria e cloroplasto.  O  DNA do núcleo é linear, já o das mitocôndrias e cloroplastos é circular, semelhante ao de bactérias. A presença desse ácido permite  a essas organelas se reproduzir.  E como em mitocôndrias e cloroplastos existem ribossomos, essas organelas podem ainda sintetizar as proteinas da respiração e fotossíntese,respectivamente. A síntese protéica de mitocondrias e cloroplastos  pode ser inibida por antibióticos, já que os ribossomos mitocondriais e cloroplásticos se parecem com os de bactérias.

DNA circular, capacidade de reprodução, ribossomos semelhantes aos de bactérias e sensibilidade  a antibióticos evidenciam a ancestralidade procariota de mitocôndria e cloroplastos.

Figura 3 Teoria endossimbiótica: mitocôndrias e cloroplastos são descendentes de bactérias. Quais são as evidências dessa teoria?


Por ter uma célula compartimentada, a síntese protéica nos eucariotos ocorrem em duas fases  fisicamente separadas. A transcrição a partir do DNA cromossômico ocorre no núcleo  e a tradução no citoplasma.  Já em procariotos a transcrição e tradução podem acontecer simultâneamente, por não existir núcleo (da mesma forma como ocorre na mitocôndria e cloroplasto).




Fig 4: Nos Procariotos (a), o RNAm  ainda sendo transcrito pode se ligar a ribossomos e já iniciar a tradução.  Nos eucaritos  (b) isso não é possível por causa da presença do envelope nuclear.  Além disso, perceba que nos eucariotos a transcrição produz um pré- RNAm  que deve ser processado para formar o RNAm , que é menor por não conter trechos chamados de introns. Assim, o splicing , que é o processamento do RNA no qual ocorre retirada de introns, só ocorre nos eucaritos.  O que são polirribossomos?




Os ribossomos são encontrados, nos eucariotos, livres no citoplasma, no retículo endoplasmático,  nas mitocondrias e cloroplastos. Os ribossomos livres sintetizam proteínas que serão utilizadas pelo citoplasma e núcleo, como enzimas ou constituintes do citoesqueleto. Vários ribossomos podem estar ligados ao mesmo RNAm, permitindo que  a partir da informação de uma molécula de RNAm se produzam várias proteínas, são os polirribossomos. Os ribossomos do retículo endoplasmático produzem proteínas que serão enviadas para o complexo de Golgi.

Figura 5: Os polirribossomos permitem a síntese  de várias proteínas iguais a partir de um mesmo RNA mensageiro. Observe na figura o sentido de deslocamento dos ribossomos e veja que o ribossomo com a maior proteína é aquele que está no final do processo da tradução.


O retículo endoplasmático e o complexo de Golgi

O retículo endoplasmático liso (REL), ou seja, aquele que não apresenta ribossomos, é o local do metabolismo de lipídeos, de carboidratos, toxinas e drogas e são, por isso, abundantes nos hepatócitos. Ele armazena e libera cálcio, o que justifica sua alta taxa em miócitos,  nos quais é chamado de retículo sarcoplasmático.

O retículo endoplasmático rugoso (RER) produz proteínas que são enviadas por vesículas para o complexo de Golgi. Participa, ainda, da formação  dos peroxissomos. Os peroxissomos  contém catalase e degradam o peróxido de hidrogênio.
Figura 6 O retículo endoplasmático funciona como um sistema de encanamento permitindo um fluxo de substâncias pela célula
Figura 7  O retículo endoplasmático rugoso está intimamente ligado ao núcleo. Assim, o RNAm se difunde do núcleo diretamente para o RER, permitindo a tradução. Além do mais, é o retículo endoplasmático que recompõe o núcleo na  telófase (final da divisão celular).

O complexo de Golgi recebe as proteínas do RER e as processa, podendo as glicosilar.  Ele empacota essas proteínas, ou seja, ele as dispõe e as concentra em vesículas que serão despachadas para 3 destinos:  secreção, glicocálice ou permanência no citoplasma como lisossomos, relacionados à digestão intracelular.

Figura 8 O Complexo de Golgi é como o despachante da célula. Ele recebe e envia substâncias.


Complexo de Golgi

Figura 9 O fluxo de material, da esquerda para direita: proteínas são sintetizadas no RER, enviadas para  o Golgi, que modifica essas proteínas. Essas são empacotadas em vesículas, enviadas para o ambiente extracelular (secreção), ou para constituir  a membrana plasmática (glicocálice) ou permanecem na célula (lisossomo).

Figura 10 Formação do glicocálice através da glicosilação de proteínas e empacotamento feitos pelo Golgi. O glicocálice participa do reconhecimento  e adesão intercelulares.


O complexo de Golgi também participa da formação do acrossomo do espermatozoide e da lamela média na citocinese vegetal.



Figura 11 Espermiogênese. O Golgi forma o acrossoma, estrutura com enzimas digestivas que possibilitam a penetração no ovócito.

Figura 12 Nos vegetais  a citocinese é centrifuga, ou seja, ocorre de dentro para fora, com a formação da lamela média, derivada do complexo de Golgi.


Figura 13 Digestão intracelular. Partículas fagocitadas se mantém em uma vesícula chamada de fagossomo, que se funde ao lisossomo formando um vacúolo digestivo. Os resíduos são liberados por exocitose.





A diferenciação celular e a distribuição de organelas

No nosso corpo, praticamente todas as células tem o mesmo DNA, entretanto não sintetizam as mesmas proteínas. Isso ocorre porque existem trechos ativos e outros inativos do DNA, o que acaba por levar a produção de proteínas diferentes por cada célula, que terão ainda formatos e distribuição diferente de organelas, o que lhes dará funções diferentes. Esse processo é chamado de diferenciação celular, e ele resulta da expressão diferencial de genes.
A divisão de trabalho de nossas células envolve, então, uma distribuição desigual de organelas e formatos celulares diferentes. Esses formatos resultam de diferentes arranjos de citoesqueleto. Observe alguns exemplos:

O enterócito, célula do intestino, apresenta microvilosidades, que aumentam a superfície absortiva. A grande quantidade de mitocôndrias permite a produção de ATP necessário para processos de transporte ativo.

 
 Célula caliciforme, especializada na secrecão de muco, apresenta  grande quantidade de vesículas de secreção.


 Hemácias: transportam O2 e a ausência de mitocôndrias favorece essa função pois a célula não consome esse gás, produzindo energia apenas por fermentação.  Seu formato bicôncavo permite grande superfície de trocas e a ausência do núcleo (perdido por autofagia) impede, por falta de DNA, tanto a síntese protéica quanto a divisão celular. Isso limita a vida da célula a 120 dias.


O hepatócito tem várias funções, o que justifica o grande desenvolvimento tanto do REL ("Smoth endoplasmatic reticulum"), que metaboliza drogas e toxinas, carboidratos (como glicogênio) e lipideos (como colesterol), quanto RER ("Rough endoplasmatic reticulum") , que sintetiza proteínas para exportação como albumina e fatores de coagulação.

O plasmócito apresenta grande quantidade de RER, também chamado de reticulo endoplasmático granular  (REG), responsável pela síntese de anticorpos.

O reticulo sarcoplasmático, o REL dos miócitos, armazena e libera cálcio, fundamental para a contração musculaar.



Revisão
1.Células procariotas tem DNA nuclear circular, não apresentam introns e por isso não realizam splicing,não apresentam organelas membranosas e nem citoesqueleto.
2.Células eucariotas são compartimentadas por estruturas membranosas chamadas organelas. O DNA é encontrado no núcleo, mitocôndria e cloroplasto, o que lhes permitem se replicar e sintetizar proteinas. Os ribossomos são encontrados livres no citoplasma, nas mitocôndrias, cloroplasto e retículo endoplasmático.
3. O retículo endoplasmático transporta substâncias. O REL metaboliza toxinas, carboidratos e lipideos, por isso é abundante em hepatócitos. E armazena cálcio, e por isso é rico nos miócitos. O RER produz proteinas para exportação, e é bastante encontrado nos plasmócitos.
4. O complexo de Golgi glicosila proteinas e as empacota enviando para três destinos: 1)secreção; 2) formação do glicocálice; 3)Lisossomos (relacionado à digestão intracelular)


Esses e outros temas serão abordados no curso Por Dentro.


Saiba mais:
Splicing: o processamento do RNAm (em breve)
Síntese protéica ( em breve)
Tecidos Animais e Vegetais


quinta-feira, 10 de abril de 2014

Aula de Virus

 

Questões sobre Genética Viral:

1.(UNIFESP-SP) No ano de 2009, o mundo foi alvo da pandemia provocada pelo vírus influenza A (H1N1), causando perdas econômicas, sociais e de vidas. O referido vírus possui, além de seus receptores protéicos, uma bicamada lipídica e um genoma constituído de 8 genes de RNA. Considerando: 1. a sequência inicial de RNA mensageiro referente a um dos genes deste vírus: 5’ AAAUGCGUUACGAAUGGUAUGCCUACUGAAU 3´
 responda:

 a) Qual será a sequência de aminoácidos que resultará da tradução da sequência inicial de RNA mensageiro, referente a um dos genes deste vírus indicada em 1?
b) Considerando os mecanismos de replicação do genoma viral, qual a principal diferença entre o vírus da gripe e o vírus que causa a AIDS?

2.UERJ- 1º EXAME QUALIF./2010) A gripe conhecida popularmente como gripe suína é causada por um vírusinfluenza A.
Esse tipo de vírus se caracteriza, dentre outros aspectos, por:
- ser formado por RNA de fita simples (-), incapaz de atuar como RNA mensageiro ou de sintetizar DNA nas células parasitadas;
- os RNA complementares do RNA viral poderem ser traduzidos em proteínas pelo aparelhamento celular.
Os esquemas a seguir apresentam um resumo de etapas dos processos de replicação de alguns dos vírus RNA, após penetrarem nas células.
Virus
O tipo de replicação encontrado no vírus infuenza A está representado no esquema de número:
a) I
b) II
c) III
d) IV

3.(UNIFAL/2008)  Os estudos sobre as formas de replicação dos vírus intensificaram-se nos últimos anos, objetivando encontrar meios mais eficientes de prevenção e tratamento de doenças virais nos seres humanos. Tais estudos têm demonstrado que existem diferentes tipos de vírus e diferentes formas de replicação. Os vírus de RNA de cadeia simples podem ser divididos em três tipos básicos, conhecidos como vírus de cadeia positiva, vírus de cadeia negativa e como retrovírus.
Com relação aos diferentes tipos de replicação dos vírus, analise as afirmativas abaixo.
I - Os retrovírus contêm cadeias simples de RNA, enzima transcriptase reversa e produzem DNA tendo como modelo o RNA viral.
II - Os vírus de cadeia negativa possuem RNA genômico com as mesmas seqüências de bases nitrogenadas dos RNA mensageiros (RNAm) formados. Dessa maneira, moléculas de RNA servem de modelo para a síntese de moléculas de RNA complementares à cadeia molde.
III - Os vírus de cadeia positiva possuem RNA genômico com seqüências de bases nitrogenadas complementares às dos RNAm formados. Desta maneira, moléculas de RNA servem de modelo para a síntese do RNAm.
IV - Os retrovírus contêm uma cadeia de RNA dupla hélice que serve de base para a transcrição do DNA necessário à replicação.
Marque a alternativa correta.
a) Somente II e III são corretas.
b) Somente IV é correta.
c) Somente I é correta.
d) Somente I, II e III são corretas.




RESPOSTAS
1.a) Não esqueça que há o códon de iniciação (AUG) e o códon de parada (UGA).
Logo, o peptídeo traduzido tem a sequência:
Metionina – Arginina – Tirosina – Ácido glutâmico – Triptofano – Tirosina– Alanina – Tirosina.
b) A replicação do vírus influenza A H1N1 envolve a enzima RNA-polimerase, que
realiza a replicação através dos RNAs virais. Já o HIV, por ser um retrovírus, utiliza a
enzima transcriptase reversa para gerar uma fita de DNA-viral, que se integra ao DNA
da célula hospedeira, e num dado momento passa a formar cópias do RNA-viral.
2b 3c

terça-feira, 1 de abril de 2014

Curso de aprofundamento em fisiologia e AULA INAUGURAL de Sistema Circulatorio


ATENDENDO A PEDIDOS: A aula de sistema circulatorio será repetida neste sábado, 12 de abril, 9:30-11:30. Inscriçoes: salabioquimica@gmail.com  valor 20 reais (com material)

domingo, 23 de março de 2014

Seminário Geografia do Brasil e Bases matemáticas para a prova de Ciências da Natureza



Neste próximo sábado vai haver o seminário de revisão Geografia do Brasil, realizado pelos alunos da sala, de 8:30 a 12:30. Não é uma aula com professor, mas uma atividade produzida pelos próprios alunos e orientada por professor.  Ou seja, é fundamental que todos estudem para o seminário.  A inscrição é 20 reais para não alunos e 10 reais para aqueles que já participam do grupo de estudo. Orientações no email salabioquimica@gmail.com .

Nos outros sábados vai se iniciar o grupo de estudo sobre Bases matemáticas para a prova de ciências da natureza, que é um curso de matemática básica ferramental para as provas de biologia, física e química. Os temas tratados serão razão e proporção, análise de gráficos, análise dimensional e logaritmo.


Videos para estudo da Geografia do Brasil

Relevo


Clima


Vegetação e hidrografia


População Brasileira


segunda-feira, 4 de novembro de 2013

Próximas aulas da sala e orientações de estudo



ORIENTAções:

Na próxima aula (amanha, terça feira), veremos sistema nervoso. É importante que você revise o tema, lembrando dos assuntos mais importantes:
1) Neurônio, impulso nervoso e neurotransmissão
2)Sistema nervoso central x periférico
3)Neurônios aferentes, eferentes, interneurônios e arco reflexo
4)Sistema nervoso simpático x parassimpático

Abaixo colocarei a lista para resolução em casa  ( confira o gabarito e anote suas dúvidas), e video-aulas para auxiliar sua revisão.




O que você quer ver no blog da Sala BioQuímica?